Marys Medicine

228_2015_1896_article 1.7

Eur J Clin PharmacolDOI 10.1007/s00228-015-1896-x CYP2B6 rs2279343 polymorphism is associated with smokingcessation success in bupropion therapy Paulo Roberto Xavier Tomaz1 & Juliana Rocha Santos1 & Jaqueline Scholz Issa2 &Tânia Ogawa Abe 2 & Patrícia Viviane Gaya2 & José Eduardo Krieger1 &Alexandre Costa Pereira1,3 & Paulo Caleb Júnior Lima Santos1,3 Received: 21 April 2015 / Accepted: 26 June 2015 # Springer-Verlag Berlin Heidelberg 2015 were genotyped by high resolution melting analysis or by Background Previous studies suggested that polymorphisms restriction fragment length polymorphism.
in the CYP2B6 gene (which encodes an isoenzyme that me- Results Patients with CYP2B6 rs2279343 wild-type AA ge- tabolizes bupropion) and in the ANKK1 gene (which is located notype had higher success rate (48.0 %) compared with pa- in the ANKK1/DRD2 gene cluster) might influence response tients carrying AG or GG genotypes (CYP2B6*4 variant) to therapy. Thus, the aim of the present study was to evaluate (35.5 %) on bupropion therapy. The AA genotype was asso- whether the CYP2B6 and ANKK1 polymorphisms are associ- ciated with higher OR for success during bupropion therapy ated with the response to smoking cessation therapies in pa- (OR = 1.92, 95 % CI = 1.08–3.42, p = 0.03) in a multivariate tients from a smoking cessation assistance program.
model. We did not observe significant differences in the Methods The cohort study enrolled 478 smokers who re- ceived behavioral counseling and drug therapy (bupropion, nicotine replacement therapy, and/or varenicline). Smoking Conclusion We showed that patients with CYP2B6*4 cessation success was considered for patients who completed (rs2279343) variant had lower success rate with bupropion.
6 months of continuous abstinence. Fagerström test for nico- Likely, the CYP2B6*4 variant, which leads to a rapid predict- tine dependence (FTND) and Issa situational smoking scores ed metabolic phenotype for the isoenzyme, influences the were analyzed for nicotine dependence (ND). The ANKK1 pharmacological activity of bupropion. Our finding suggests that CYP2B6*4 may be an important genetic marker for indi- (rs3211371), and CYP2B6*9 (rs3745274) polymorphisms vidualized bupropion pharmacotherapy.
Keywords Pharmacogenetics . CYP2B6 gene . ANKK1 Electronic supplementary material The online version of this article (docontains supplementary material,which is available to authorized users.
* Alexandre Costa Pereira Tobacco is a leading cause of preventable morbidity and pre- * Paulo Caleb Júnior Lima Santos mature mortality worldwide, accounting for about six milliondeaths per year. If tobacco control policies are not strength- ened, surveys show that tobacco induced mortality will reach Laboratory of Genetics and Molecular Cardiology, Heart Institute 8.3 million in 2030, mostly affecting developing countries (InCor), University of Sao Paulo Medical School, Sao Paulo, Brazil Smoking is associated with the majority of cardiovascular Smoking Cessation Program Department, Heart Institute (InCor), diseases and cancer and with poor quality of life of smokers University of Sao Paulo Medical School, Sao Paulo, Brazil Laboratory of Genetics and Molecular Cardiology, Heart Institute, Studies report that treatments for smoking cessation using University of Sao Paulo Medical School, Av. Dr. Enéas de CarvalhoAguiar, 44 Cerqueira César, São Paulo, SP CEP 05403-000, Brazil drugs are much more effective than those made without drugs Eur J Clin Pharmacol ]. Varenicline has been reported as an important drug in behavioral counseling and drug treatment from physicians the pharmacotherapy of smoking cessation. The main targets specialized in smoking cessation. Arbitrarily, bupropion plus are α4β2 subunits of the nicotinic acetylcholine receptors NRT was prescribed for patients who smoked less than one (nAChRs) not only promoting an antagonistic effect in the cigarette pack per day, while varenicline was prescribed for presence of nicotine but also acting as a partial agonist [ patients who smoked one or more cigarette pack(s) per day or Bupropion is the only antidepressant approved as a first- who failed in previous attempts with bupropion plus NRT.
line drug for smoking cessation and its presumed mechanism Our prescription to start co-administration of bupropion and of action involves modulation of dopaminergic and noradren- varenicline was if the patient was unable to quit smoking after ergic systems [].
2 or 3 weeks of starting varenicline use, or if the patient Twin and genome-wide association studies showed that stopped smoking, but presented moderate or intense discom- genes have an important role in different smoking-related phe- fort abstinence symptoms. Continuous abstinence (CA) was notypes ]. Recent studies showed that the persistence of investigated after 6 months as of starting pharmacotherapy. In smoking and consequently the difficulty of smoking cessation our analysis, we compared success group (patients who com- have a great influence of genetic factors, with a heritability of pleted 6 months of CA confirmed by end-expiratory exhaled approximately 50 % [Thus, it is clear that genetic carbon monoxide) vs patients who did not achieved CA information can lead us to a better understanding about effec- tiveness of anti-smoking therapies.
We analyzed the Fagerström test for nicotine dependence Pharmacogenetic studies identified associations of the (FTND) and Issa situational smoking score (Issa score). The CYP2B6 and ANKK1 polymorphisms with response to FTND comprises six questions and classifies patients into five bupropion therapy [–]. Thus, we chose the main poly- categories (ranging from 0 to 10 points): 1–2 points = very morphism in both genes. The first gene encodes the isoen- low dependence; 3–4 points = low dependence; 5 zyme that metabolizes bupropion. The second, ANKK1 (ki- points = medium dependence; 6–7 points = high dependence; nase domain and ankyrin repeat containing 1), encodes a pro- and 8–10 points = very high dependence. The FTND is used tein involved in protein–protein interactions in the transduc- in many countries as a cheap, non-invasive, and easy way to tion pathways signal. It is located in the ANKK1/DRD2 gene assess ND [The Issa score comprises four questions cluster on chromosome 11q23.2, and the DRD2 gene encodes (ranging from 0 to 4 points) with one point for each affirma- type 2 dopamine receptor tive response ]. This score is based on the psychoactive In this context of personalized medicine, the main aim of effects of nicotine in the process of cognition, attention, con- the present study was to evaluate whether the CYP2B6 and centration, mood, well-being, and pleasure ANKK1 polymorphisms are associated with response tosmoking cessation therapies in patients from a smoking ces- sation assistance program.
Genomic DNA from subjects was extracted from peripheralblood following a standard salting-out procedure. Genotyping for the ANKK1 rs1800497 (c.G2137A [Taq 1A]) was per-formed by polymerase chain reaction (PCR) followed by high resolution melting (HRM) analysis according to previousstudies ]. Amplification of the fragment for the ANKK1 This cohort study included 478 smoking patients from the rs1800497 was performed using the following primer sense PAF (Programa de Assistência ao Fumante/Smoker Assis- and antisense: 5′- GGTGTGCAGCTCACTCCAT -3′ and 5′- tance Program), Heart Institute (InCor), University of Sao ACAGCCATCCTCAAAGTGCT -3′ (71 base pairs).
Paulo Medical School, Sao Paulo, Brazil, between January CYP2B6 (rs3745274, rs2279343, and rs3211371) polymor- 2007 and September 2013. The study protocol was approved phisms were genotyped by PCR followed by restriction frag- by the Institutional Ethics Committee (0022/11), and written ment length polymorphism previously described by Lang et al informed consent was obtained from all participants prior to Supplementary shows enzymes, reagents, and entering the study.
fragments for the polymorphisms. Six percent of the samples The study design was based on PAF, which consisted of an was randomly selected and reanalyzed as quality controls and initial medical visit plus an average of four follow-up medical gave identical results.
visits for 12 weeks. The follow-up was made by phone inpatients who did not continue to come on scheduled medical Statistical analysis visits. Clinical data and end-expiratory exhaled carbon mon-oxide (CO) were collected in all visits. Demographic, socio- Continuous variables are presented as mean and standard de- economic, and clinical data were acquired. Patients received viation and categorical variables as frequencies. Chi-square Eur J Clin Pharmacol test was performed for the comparative analysis of categorical polymorphism in the overall patient sample and in patients variables (general characteristics, smoking status rates, and treated with bupropion, respectively.
categorized nicotine dependence scores) according to poly- The frequency of CYP2B6 rs2279343 G, CYP2B6 morphisms. The Student's t test was used for comparing gen- rs3745274 T, CYP2B6 rs3211371 T, and ANKK1 rs1800497 eral characteristics and FTND according to polymorphisms.
A alleles were 28.2, 29.6, 8.2, and 24.7 %, respectively. The Logistic regression univariate and multivariate models were genotypic distributions for the rs2279343, rs3745274, and performed to evaluate the odds ratio (OR) for success. Anal- rs1800497 were in accordance with Hardy–Weinberg equilib- ysis for the CYP2B6 (rs3745274, rs2279343, and rs321137) rium (HWE) (X2 = 0.42; p = 0.52; X2 = 0.005; p = 0.94; polymorphisms was performed using dominant models, i.e., X2 = 0.15; p = 0.70, respectively). The genotypic distribution CYP2B6*4 rs2279343 (AA vs AG + GG), CYP2B6*5 for the rs3211371 polymorphism was not in HWE (X2 = 8.80; rs3211371 (CC vs CT + TT), and CYP2B6*9 rs3745274 (GG vs GT + TT), as previously described [For theANKK1 rs1800497, a dominant model (GG vs GA + AA)was adopted based on previous studies [Linear regres- Smoking cessation success according to CYP2B6 sion models for FTND score were conducted to evaluate the influence of polymorphisms in the presence of covariables.
Linkage disequilibrium, Hardy–Weinberg equilibrium, and Table shows the smoking cessation success rate of patients haplotype analysis were conducted with Haploview 4.0. sta- according to prescribed drugs and CYP2B6 rs2279343 poly- tistical analyses were carried out using the SPSS software morphism. Patients with CYP2B6 rs2279343 wild-type AA (v.16.0), with the level of significance set at p ≤ 0.05.
genotype had higher success rate (48.0 %) compared withpatients carrying AG or GG genotypes (CYP2B6*4 variant)(35.5 %) on bupropion therapy.
Table shows a logistic regression analysis for smoking cessation success in the patient group treated with bupropion General characteristics and CYP2B6 and ANKK1 (n = 237). The AA genotype for CYP2B6 rs2279343 polymor- phism was associated with higher OR for success (OR = 1.92,95 % CI = 1.08–3.42, p = 0.03) in a multivariate model for Tables and show general and clinical characteristics ac- sex, age, race, FTND score, and co-administration of NRT. In cording CYP2B6*4 rs2279343 (AA vs AG + GG) the patient group treated with bupropion, some patients used Table 1 Demographic andclinical characteristics of overall AG or GG (n = 229) patients according to CYP2B6rs2279343 polymorphism Gender, female (%) Self-declared race, White (%) Scholarity, college (%) Body mass index (kg/m2) Issa score, ≥3 (%) Coronary artery disease (%) Acute myocardial infarction (%) Diabetes mellitus type 2 (%) Obstructive pulmonary chronic disease (%) Number of diagnosed diseases FTND Fagerström test for nicotine dependence (range from 0 to 10 points) (n = 478), Issa score Issa situationalsmoking score (range from 0 to 4 points) (n = 67) Eur J Clin Pharmacol Table 2 Demographic andclinical characteristics of patients AG or GG (n = 110) treated with bupropion accordingto CYP2B6 rs2279343 Gender, female (%) Self-declared race, White (%) Scholarity, (college) Body mass index (kg/m2) Coronary artery disease (%) Acute myocardial infarction (%) Diabetes mellitus type 2 (%) Obstructive pulmonary chronic disease (%) Number of diagnosed diseases FTND Fagerström test for nicotine dependence (range from 0 to 10 points) NRT (patch and/or gum, n = 192), and this variable was added Linkage disequilibrium analysis shows that the studied as a covariate in the multivariate model.
CYP2B6 polymorphisms are not in strong disequilibrium inour patient sample (Supplementary Figure In a haplotypeanalysis, the GAC and GAT haplotypes for the CYP2B6 were Smoking cessation success according to CYP2B6*5, *6, associated with smoking cessation success (p values: 0.04, *9, and ANKK1 rs1800497 polymorphisms Smoking cessation success rate did not have significant dif-ferences among CYP2B6*5 (rs3211371), *6 (rs2279343 + FTND and Issa scores according to CYP2B6 and ANKK1 rs3745374), *9 (rs3745274), and ANKK1 rs1800497 geno- types for all drug groups, even in a multivariate model.
For the group treated with bupropion, the CYP2B6*5, We did not observe significant differences in the FTND and CYP2B6*6, and CYP2B6*9 polymorphisms showed the fol- Issa scores according to rs2279343 polymorphism in the over- lowing OR for success: 0.71 (95 % CI = 0.29–1.72, p = 0.44), all patient group (Table ). In addition, studied polymor- 0.64 (95 % CI = 0.38–1.08, p = 0.11), and 0.62 (95 % phisms were not associated with FTND score in multiple lin- CI = 0.35–1.09, p = 0.10), respectively. The AG or GG geno- ear regression models (Supplementary ).
types for ANKK1 rs1800497 polymorphism showed OR forsuccess of 0.82 (95 % CI = 0.46–1.48, p = 0.51) in a multi-variate model.
Logistic regression multivariate analysis for smoking cessation success in the patients submitted to bupropion therapy (n = 237) Smoking cessation success rate of patients according to prescribed drugs and CYP2B6 rs2279343 polymorphism AA genotype for the CYP2B6 rs2279343 Overall (n = 478) Self-declared race (White) Varenicline (n = 164) Varenicline plus bupropion (n = 77) Co-administration of gum and/or patch Bupropion (n = 237) FTND Fagerström test for nicotine dependence Eur J Clin Pharmacol nicotine compared with non-dependents ]. Erblich et al.
showed that smokers carrying at least one ANKK1 The main finding in the present study was the association of c.G2137A variant allele had higher craving to smoke com- the CYP2B6*4 with response to bupropion. Our hypothesis is pared with wild-type patients that the pharmacological activity of bupropion could be al- There are some limitations in this study. First, the sample tered by the functionality of the CYP2B6 isoenzyme with size of patients treated with bupropion is relatively small.
the CYP2B6 rs2279343. This variant predicts a rapid metabol- However, this study was effective to identify significant dif- ic phenotype for the isoenzyme which mediates almost exclu- ferences between genotypes, even in a multivariate analysis.
sively the hydroxylation process of the drug [, Thus, Second, the range in the FTND score is small in this patient patients carrying CYP2B6*4 AG or GG had lower success rate cohort because most of the patients were classified as having in the smoking cessation therapy.
moderate to strong dependency. Third, a preliminary analysis The CYP2B6 rs2279343 is a single-nucleotide polymor- of liver function of patients based on laboratory tests was not phism in the exon 5 resulting the change of the acid arginine performed; however, patients were asked about the presence for the lysine. Zanger et al. reported that this polymorphism of liver diseases as an exclusion criterion.
leads to higher protein expression and Kirchheiner et al.
In conclusion, we showed that patients with CYP2B6*4 showed that individuals with the CYP2B6*4 (AG or GG) had (rs2279343) variant had lower success rate with bupropion.
an increased bupropion clearance ]. In this context, the Likely, the CYP2B6*4 variant, which leads to a rapid predict- hypothesis generated in this study is that patients with the ed metabolic phenotype for the isoenzyme, influences the AA genotype (wild type) for the rs2279343 have a predicted pharmacological activity of the bupropion. Our finding sug- metabolic phenotype considered normal, maintaining an in- gests that CYP2B6*4 may be an important genetic marker for creased drug concentration in the plasma and a longer period individualized pharmacotherapy of the bupropion.
of time in the organism, while patients with the AG or GGgenotypes have a predicted metabolic phenotype considered PCJL Santos is a recipient of fellowship and rapid; consequently, the drug acts for a shorter time in the funding from FAPESP (Proc. 2013-09295-3 and Proc. 2013-20614-3)and from CNPq (Proc. 470410/2013-2), Brazil. PRX Tomaz is recipient organism. Thus, carriers of AA genotype have higher success of fellowship from CAPES, Brazil. JR Santos is a recipient of fellowship rate for anti-smoking therapy with bupropion. However, an from CNPq, Proc. 167587/2013-7, Brazil. We also thank the patients who interesting study indicated that hydroxybupropion, the main participated in the study. The technical assistance of the Laboratory of bupropion active metabolite, contributed to the pharmacologic Genetics and Molecular Cardiology group, the FAPESP Proc.
2013/17368-0, and Sociedade Hospital Samaritano – Ministério da Saúde effects of bupropion and that variability in response to (PROADI-SUS; SIPAR: 25000.180.672/2011-81) are gratefully bupropion treatment was related to variability in CYP2B6- mediated hydroxybupropion formation ]. Thus, furtherstudies are needed to confirm hypotheses which involve Conflict of interest The authors declare that they have no competing CYP2B6 variants, metabolites, and pharmacological response.
No significant difference for the CYP2B6*5, *6, *9, and ANKK1 rs1800497 polymorphisms was found with any stud- ied phenotypes. In addition, no association of these polymor-phisms with response to varenicline treatment was observed.
Hiilamo H, Glantz SA (2015) Implementation of effective cigarette Kirchheiner et al. and Burger et al. did not find associations of health warning labels among low and middle income countries: the CYP2B6*5, *6, *9, and ANKK1 rs1800497 polymor- state capacity, path-dependency and tobacco industry activity. Soc phisms with the bupropion clearance compared with wild- Sci Med 124C:241–245 type (CYP2B6*1). But, Lerman et al. showed that carriers of Tomioka H, Sekiya R, Nishio C, Ishimoto G. Impact of smoking the *5 variant had less tobacco abstinence and bupropion re- cessation therapy on health-related quality of life. BMJ Open RespirRes 2014;1:e000047.
duced this effect in women, increasing the likelihood of A clinical practice guideline for treating tobacco use and depen- smoking cessation ]. For the *9 and *6 variants, some dence: 2008 update. A U.S. Public Health Service report. Am J studies showed decreased enzymatic function [].
Prev Med 2008;35:158-176.
Regarding the ANKK1 polymorphism, Lerman et al. and Da- Pine-Abata H, McNeill A, Murray R, Bitton A, Rigotti N, Raw M(2013) A survey of tobacco dependence treatment services in 121 vid et al. showed that smokers with GG genotype were asso- countries. Addiction 108:1476–1484 ciated with better response with bupropion [, Kasza KA, Hyland AJ, Borland R, McNeill AD, Bansal-Travers M, Regarding FTND score, Verde et al. did not find associa- Fix BV, et al. (2013) Effectiveness of stop-smoking medications: tions with *4 and *9 variants and Bierut et al. and Single- findings from the International Tobacco Control (ITC) four countrysurvey. Addiction 108:193–202 ton et al. did not find associations with ANKK1 polymor- Jorenby DE, Hays JT, Rigotti NA, Azoulay S, Watsky EJ, Williams phisms [–]. On the other hand, Riccardi et al. reported a KE, et al. (2006) Efficacy of varenicline, an alpha4beta2 nicotinic higher frequency of patients with *6 variant in dependents of acetylcholine receptor partial agonist, vs placebo or sustained- Eur J Clin Pharmacol release bupropion for smoking cessation: a randomized controlled Santos PC, Soares RA, Santos DB, Nascimento RM, Coelho GL, trial. JAMA 296:56–63 Nicolau JC, et al. (2011) CYP2C19 and ABCB1 gene polymor- Koegelenberg CF, Noor F, Bateman ED, van Zyl-Smit RN, Bruning phisms are differently distributed according to ethnicity in the A, O'Brien JA, et al. (2014) Efficacy of varenicline combined with Brazilian general population. BMC Med Genet 12:13 nicotine replacement therapy vs varenicline alone for smoking ces- Santos PC, Soares RA, Nascimento RM, Machado-Coelho GL, sation: a randomized clinical trial. JAMA 312:155–161 Mill JG, Krieger JE, et al. (2011) SLCO1B1 rs4149056 polymor- Espanol E, Kelsberg G, Safranek S (2014) Clinical inquiry: does phism associated with statin-induced myopathy is differently dis- any antidepressant besides bupropion help smokers quit? J Fam tributed according to ethnicity in the Brazilian general population: Pract 63:680–688 Amerindians as a high risk ethnic group. BMC Med Genet 12:136 Verde Z, Santiago C, Rodriguez Gonzalez-Moro JM, de Lucas Lang T, Klein K, Fischer J, Nussler AK, Neuhaus P, Hofmann U, Ramos P, Lopez Martin S, Bandres F, et al. ‘Smoking genes': a et al. (2001) Extensive genetic polymorphism in the human genetic association study. PLoS One 2011;6:e26668.
CYP2B6 gene with impact on expression and function in human Broms U, Silventoinen K, Madden PA, Heath AC, Kaprio J (2006) liver. Pharmacogenetics 11:399–415 Genetic architecture of smoking behavior: a study of Finnish adult Zhang H, Sridar C, Kenaan C, Amunugama H, Ballou DP, twins. Twin Res Hum Genet 9:64–72 Hollenberg PF (2011) Polymorphic variants of cytochrome P450 Lessov CN, Martin NG, Statham DJ, Todorov AA, Slutske WS, 2B6 (CYP2B6.4-CYP2B6.9) exhibit altered rates of metabolism Bucholz KK, et al. (2004) Defining nicotine dependence for genetic for bupropion and efavirenz: a charge-reversal mutation in the research: evidence from Australian twins. Psychol Med 34:865–879 K139E variant (CYP2B6.8) impairs formation of a functional cy- Bierut LJ, Madden PA, Breslau N, Johnson EO, Hatsukami D, tochrome p450-reductase complex. J Pharmacol Exp Ther 338: Pomerleau OF, et al. (2007) Novel genes identified in a high- density genome wide association study for nicotine dependence.
Lerman C, Shields PG, Wileyto EP, Audrain J, Hawk Jr. LH, Pinto Hum Mol Genet 16:24–35 A, et al. (2003) Effects of dopamine transporter and receptor poly- Saccone SF, Hinrichs AL, Saccone NL, Chase GA, Konvicka K, morphisms on smoking cessation in a bupropion clinical trial.
Madden PA, et al. (2007) Cholinergic nicotinic receptor genes im- Health Psychol 22:541–548 plicated in a nicotine dependence association study targeting 348 Hesse LM, Venkatakrishnan K, Court MH, von Moltke LL, Duan candidate genes with 3713 SNPs. Hum Mol Genet 16:36–49 SX, Shader RI, et al. (2000) CYP2B6 mediates the in vitro hydrox- Lerman CE, Schnoll RA, Munafo MR (2007) Genetics and ylation of bupropion: potential drug interactions with other antide- smoking cessation improving outcomes in smokers at risk. Am J pressants. Drug Metab Dispos 28:1176–1183 Prev Med 33:S398–S405 Faucette SR, Hawke RL, Lecluyse EL, Shord SS, Yan B, Laethem Xian H, Scherrer JF, Madden PA, Lyons MJ, Tsuang M, True WR, RM, et al. (2000) Validation of bupropion hydroxylation as a selec- et al. (2003) The heritability of failed smoking cessation and nico- tive marker of human cytochrome P450 2B6 catalytic activity. Drug tine withdrawal in twins who smoked and attempted to quit.
Metab Dispos 28:1222–1230 Nicotine Tob Res 5:245–254 Zanger UM, Klein K (2013) Pharmacogenetics of cytochrome Lerman C, Shields PG, Wileyto EP, Audrain J, Pinto A, Hawk L, P450 2B6 (CYP2B6): advances on polymorphisms, mechanisms, et al. (2002) Pharmacogenetic investigation of smoking cessation and clinical relevance. Front Genet 4:24 treatment. Pharmacogenetics 12:627–634 Kirchheiner J, Klein C, Meineke I, Sasse J, Zanger UM, Murdter David SP, Brown RA, Papandonatos GD, Kahler CW, Lloyd- TE, et al. (2003) Bupropion and 4-OH-bupropion pharmacokinetics Richardson EE, Munafo MR, et al. (2007) Pharmacogenetic clini- cal trial of sustained-release bupropion for smoking cessation.
Nicotine Tob Res 9:821–833 Zhu AZ, Cox LS, Nollen N, Faseru B, Okuyemi KS, Ahluwalia JS, David SP, Niaura R, Papandonatos GD, Shadel WG, Burkholder GJ, et al. (2012) CYP2B6 and bupropion's smoking-cessation pharma- Britt DM, et al. (2003) Does the DRD2-Taq1 A polymorphism influ- cology: the role of hydroxybupropion. Clin Pharmacol Ther 92: ence treatment response to bupropion hydrochloride for reduction of the nicotine withdrawal syndrome? Nicotine Tob Res 5:935–942 Han DH, Joe KH, Na C, Lee YS (2008) Effect of genetic polymor- Telenti A, Zanger UM (2008) Pharmacogenetics of anti-HIV drugs.
phisms on smoking cessation: a trial of bupropion in Korean male Annu Rev Pharmacol Toxicol 48:227–256 smokers. Psychiatr Genet 18:11–16 Rakhmanina NY, van den Anker JN (2010) Efavirenz in the therapy Dubertret C, Gouya L, Hanoun N, Deybach JC, Ades J, Hamon M, of HIV infection. Expert Opin Drug Metab Toxicol 6:95–103 et al. (2004) The 3′ region of the DRD2 gene is involved in genetic Hofmann MH, Blievernicht JK, Klein K, Saussele T, Schaeffeler E, susceptibility to schizophrenia. Schizophr Res 67:75–85 Schwab M, et al. (2008) Aberrant splicing caused by single nucle- Neville MJ, Johnstone EC, Walton RT (2004) Identification and otide polymorphism c.516G>T [Q172H], a marker of CYP2B6*6, characterization of ANKK1: a novel kinase gene closely linked to is responsible for decreased expression and activity of CYP2B6 in DRD2 on chromosome band 11q23.1. Hum Mutat 23:540–545 liver. J Pharmacol Exp Ther 325:284–292 Arenaz I, Vicente J, Fanlo A, Vasquez P, Medina JC, Conde B, et al.
Nyakutira C, Roshammar D, Chigutsa E, Chonzi P, Ashton M, (2010) Haplotype structure and allele frequencies of CYP2B6 in Nhachi C, et al. (2008) High prevalence of the CYP2B6 Spaniards and Central Americans. Fundam Clin Pharmacol 24: 516G–>T(*6) variant and effect on the population pharmacokinet- ics of efavirenz in HIV/AIDS outpatients in Zimbabwe. Eur J Clin Issa JS, Abe TO, Moura S, Santos PC, Pereira AC (2013) Pharmacol 64:357–365 Effectiveness of coadministration of varenicline, bupropion, and Hesse LM, He P, Krishnaswamy S, Hao Q, Hogan K, von Moltke serotonin reuptake inhibitors in a smoking cessation program in LL, et al. (2004) Pharmacogenetic determinants of interindividual the real-life setting. Nicotine Tob Res 15:1146–1150 variability in bupropion hydroxylation by cytochrome P450 2B6 in Issa JS, Santos PC, Vieira LP, Abe TO, Kuperszmidt CS, Nakasato human liver microsomes. Pharmacogenetics 14:225–238 M, et al. (2014) Smoking cessation and weight gain in patients with Bierut LJ, Rice JP, Edenberg HJ, Goate A, Foroud T, Cloninger CR, cardiovascular disease or risk factor. Int J Cardiol 172:485–487 et al. (2000) Family-based study of the association of the dopamine Fagerstrom KO, Heatherton TF, Kozlowski LT (1990) Nicotine D2 receptor gene (DRD2) with habitual smoking. Am J Med Genet addiction and its assessment. Ear Nose Throat J 69:763–765 Eur J Clin Pharmacol Singleton AB, Thomson JH, Morris CM, Court JA, Lloyd S, Riccardi LN, Carano F, Bini C, Ceccardi S, Ferri G, Pelotti S.
Cholerton S (1998) Lack of association between the dopamine CYP2B6 gene single-nucleotide polymorphisms in an Italian pop- D2 receptor gene allele DRD2*A1 and cigarette smoking in a ulation sample and relationship with nicotine dependence. Genet United Kingdom population. Pharmacogenetics 8:125–128 Test Mol Biomarkers; 2015.
Johnstone EC, Yudkin P, Griffiths SE, Fuller A, Murphy M, Walton Erblich J, Lerman C, Self DW, Diaz GA, Bovbjerg DH (2004) R (2004) The dopamine D2 receptor C32806T polymorphism Stress-induced cigarette craving: effects of the DRD2 TaqI RFLP (DRD2 Taq1A RFLP) exhibits no association with smoking behav- and SLC6A3 VNTR polymorphisms. Pharmacogenomics J 4:102– iour in a healthy UK population. Addict Biol 9:221–226

Source: http://www.deixardefumar.com.br/docs/tabagismo/pub/2015/CYP2B6_rs2279343.pdf